rad18 cell signaling technology (Cell Signaling Technology Inc)
Cell Signaling Technology Inc is a verified supplier 
Cell Signaling Technology Inc manufactures this product 
94
Structured Review
Cell Signaling Technology Inc
rad18 cell signaling technology
Rad18 Cell Signaling Technology, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 94/100, based on 57 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/rad18+cell+signaling+9040/Rad18+XP+Rabbit+mAb/pmc11909274__41467_2025_56981_MOESM2_ESM-27-82-83
Average 94 stars, based on 57 article reviews
Rad18 Cell Signaling Technology, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 94/100, based on 57 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/rad18+cell+signaling+9040/Rad18+XP+Rabbit+mAb/pmc11909274__41467_2025_56981_MOESM2_ESM-27-82-83
Average 94 stars, based on 57 article reviews
rad18 cell signaling technology - by Bioz Stars,
2026-09
94/100 stars
Images
Related Articles
other:Article Title: CRISPR knockout genome-wide screens identify the HELQ-RAD52 axis in regulating the repair of cisplatin-induced single-stranded DNA gaps. Article Snippet: on 08 D ecem ber 2024 owing oligonucleotide sequences (Stealth or SilencerSelect iRNA, Thermo Fisher Scientific) were used: PRIMPOL: ID: 39536; HELQ#1: C AC AGAGAACC AGAGUGGAU AUGAA; HELQ#2: ID:125860; HELQ#3: ID: s41483; NBN: ID: s529215; PARP2: ID: s19504; POLD3#1: ID: s21045; POLD3#2: ID: 119736; RAD52#1: ID: s11746; RAD52#2: ID: s532174; MUS81: UUUGCUGGGUCUCUA GGA UUGGUCU; ZRANB3: UGGC AAUGU AGUCUCUGC ACCU AU A; UBC13: ID: s14595 RAD18: ID: s32295 Denatured whole cell extracts were prepared by boiling ells in 100 mM Tris, 4% sodium dodecyl sulfate and 0.5 M βercaptoethanol Western Blot:Article Title: CRISPR knockout genome-wide screens identify the HELQ-RAD52 axis in regulating the repair of cisplatin-induced single-stranded DNA gaps Article Snippet: The following oligonucleotide sequences (Stealth or SilencerSelect siRNA, Thermo Fisher Scientific) were used: PRIMPOL: ID: 39536; HELQ#1: CACAGAGAACCAGAGUGGAUAUGAA; HELQ#2: ID:125860; HELQ#3: ID: s41483; NBN: ID: s529215; PARP2: ID: s19504; POLD3#1: ID: s21045; POLD3#2: ID: 119736; RAD52#1: ID: s11746; RAD52#2: ID: s532174; MUS81: UUUGCUGGGUCUCUAGGAUUGGUCU; ZRANB3: UGGCAAUGUAGUCUCUGCACCUAUA; UBC13: ID: s14595 RAD18: ID: s32295 Denatured whole cell extracts were prepared by boiling cells in 100 mM Tris, 4% sodium dodecyl sulfate and 0.5 M β-mercaptoethanol. .. Antibodies used for western blot, at 1:500 dilution, were: PRIMPOL: Proteintech 29824–1-AP; HELQ: Invitrogen PA5-88692; POLD3: Invitrogen PA5-96618; RAD52: Santa Cruz sc-365341; MUS81: Santa Cruz sc-47692; BRCA2: Bethyl A303-434A; ZRANB3: Invitrogen PA5-65143; UBC13: Santa Cruz Biotechnology sc-376470; |